Please register to participate in our discussions with 2 million other members - it's free and quick! Some forums can only be seen by registered members. After you create your account, you'll be able to customize options and access all our 15,000 new posts/day with fewer ads.
The point still stands. While a mutation may be beneficial for survival in a particular situation, it still accounts for a LOSS of INFORMATION not a gain. That particular mutation won't improve survival for ALL situations and doesn't CREATE a more advanced CREATURE - just one more adapted to that particular situation. DNA is information. We never see NEW INFORMATION in mutations. Maybe a copy, but not NEW INFORMATION. It requires a HUGE LEAP OF FAITH to believe the complexity we see in nature has evolved in a series of reactions that are merely speculated throughout eons of time reached through assumptions that evolution is true.
New information is created in some mutations. From wiki article on mutation:
Quote:
By effect on structure
The sequence of a gene can be altered in a number of ways. Gene mutations have varying effects on health depending on where they occur and whether they alter the function of essential proteins. Mutations in the structure of genes can be classified as:
Small-scale mutations, such as those affecting a small gene in one or a few nucleotides, including:
Point mutations, often caused by chemicals or malfunction of DNA replication, exchange a single nucleotide for another.[26] These changes are classified as transitions or transversions.[27] Most common is the transition that exchanges a purine for a purine (A ↔ G) or a pyrimidine for a pyrimidine, (C ↔ T). A transition can be caused by nitrous acid, base mis-pairing, or mutagenic base analogs such as 5-bromo-2-deoxyuridine (BrdU). Less common is a transversion, which exchanges a purine for a pyrimidine or a pyrimidine for a purine (C/T ↔ A/G). An example of a transversion is adenine (A) being converted into a cytosine (C). A point mutation can be reversed by another point mutation, in which the nucleotide is changed back to its original state (true reversion) or by second-site reversion (a complementary mutation elsewhere that results in regained gene functionality). Point mutations that occur within the protein coding region of a gene may be classified into three kinds, depending upon what the erroneous codon codes for:
Silent mutations: which code for the same amino acid.
Missense mutations: which code for a different amino acid.
Nonsense mutations: which code for a stop and can truncate the protein.
Insertions add one or more extra nucleotides into the DNA. They are usually caused by transposable elements, or errors during replication of repeating elements (e.g. AT repeats[citation needed]). Insertions in the coding region of a gene may alter splicing of the mRNA (splice site mutation), or cause a shift in the reading frame (frameshift), both of which can significantly alter the gene product. Insertions can be reverted by excision of the transposable element.
Deletions remove one or more nucleotides from the DNA. Like insertions, these mutations can alter the reading frame of the gene. They are generally irreversible: though exactly the same sequence might theoretically be restored by an insertion, transposable elements able to revert a very short deletion (say 1–2 bases) in any location are either highly unlikely to exist or do not exist at all. Note that a deletion is not the exact opposite of an insertion: the former is quite random while the latter consists of a specific sequence inserting at locations that are not entirely random or even quite narrowly defined.
Large-scale mutations in chromosomal structure, including:
Amplifications (or gene duplications) leading to multiple copies of all chromosomal regions, increasing the dosage of the genes located within them.
Deletions of large chromosomal regions, leading to loss of the genes within those regions.
Mutations whose effect is to juxtapose previously separate pieces of DNA, potentially bringing together separate genes to form functionally distinct fusion genes (e.g. bcr-abl). These include:
Chromosomal translocations: interchange of genetic parts from nonhomologous chromosomes.
Interstitial deletions: an intra-chromosomal deletion that removes a segment of DNA from a single chromosome, thereby apposing previously distant genes. For example, cells isolated from a human astrocytoma, a type of brain tumor, were found to have a chromosomal deletion removing sequences between the "fused in glioblastoma" (fig) gene and the receptor tyrosine kinase "ros", producing a fusion protein (FIG-ROS). The abnormal FIG-ROS fusion protein has constitutively active kinase activity that causes oncogenic transformation (a transformation from normal cells to cancer cells).
Chromosomal inversions: reversing the orientation of a chromosomal segment.
Loss of heterozygosity: loss of one allele, either by a deletion or recombination event, in an organism that previously had two different alleles.
By effect on function
Loss-of-function mutations are the result of gene product having less or no function. When the allele has a complete loss of function (null allele) it is often called an amorphic mutation. Phenotypes associated with such mutations are most often recessive. Exceptions are when the organism is haploid, or when the reduced dosage of a normal gene product is not enough for a normal phenotype (this is called haploinsufficiency).
Gain-of-function mutations change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes. Often called a neomorphic mutation.
Dominant negative mutations (also called antimorphic mutations) have an altered gene product that acts antagonistically to the wild-type allele. These mutations usually result in an altered molecular function (often inactive) and are characterised by a dominant or semi-dominant phenotype. In humans, Marfan syndrome is an example of a dominant negative mutation occurring in an autosomal dominant disease. In this condition, the defective glycoprotein product of the fibrillin gene (FBN1) antagonizes the product of the normal allele.
Lethal mutations are mutations that lead to the death of the organisms which carry the mutations.
A back mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.[28]
See also Behavior mutation. By effect on fitness
In applied genetics it is usual to speak of mutations as either harmful or beneficial.
A harmful mutation is a mutation that decreases the fitness of the organism.
A beneficial mutation is a mutation that increases fitness of the organism, or which promotes traits that are desirable.
In theoretical population genetics, it is more usual to speak of such mutations as deleterious or advantageous. In the neutral theory of molecular evolution, genetic drift is the basis for most variation at the molecular level.
A neutral mutation has no harmful or beneficial effect on the organism. Such mutations occur at a steady rate, forming the basis for the molecular clock.
A deleterious mutation has a negative effect on the phenotype, and thus decreases the fitness of the organism.
An advantageous mutation has a positive effect on the phenotype, and thus increases the fitness of the organism.
A nearly neutral mutation is a mutation that may be slightly deleterious or advantageous, although most nearly neutral mutations are slightly deleterious.
In reality, viewing the fitness effects of mutations in these discrete categories is an oversimplification. Attempts have been made to infer the distribution of fitness effects using mutagenesis experiments or theoretical models applied to molecular sequence data. However, the current distribution is still uncertain, and some aspects of the distribution likely vary between species.[20]
By inheritance
inheritable generic in pro-generic tissue or cells on path to be changed to gametes.
non inheritable somatic (e.g., carcinogenic mutation)
non inheritable post mortem aDNA mutation in decaying remains.
By pattern of inheritance The human genome contains two copies of each gene – a paternal and a maternal allele.
A heterozygous mutation is a mutation of only one allele.
A homozygous mutation is an identical mutation of both the paternal and maternal alleles.
Compound heterozygous mutations or a genetic compound comprises two different mutations in the paternal and maternal alleles.[29]
A wildtype or homozygous non-mutated organism is one in which neither allele is mutated. By impact on protein sequence
A frameshift mutation is a mutation caused by insertion or deletion of a number of nucleotides that is not evenly divisible by three from a DNA sequence. Due to the triplet nature of gene expression by codons, the insertion or deletion can disrupt the reading frame, or the grouping of the codons, resulting in a completely different translation from the original.[30] The earlier in the sequence the deletion or insertion occurs, the more altered the protein produced is.
In contrast, any insertion or deletion that is evenly divisible by three is termed an in-frame mutation
A nonsense mutation is a point mutation in a sequence of DNA that results in a premature stop codon, or a nonsense codon in the transcribed mRNA, and possibly a truncated, and often nonfunctional protein product.
Missense mutations or nonsynonymous mutations are types of point mutations where a single nucleotide is changed to cause substitution of a different amino acid. This in turn can render the resulting protein nonfunctional. Such mutations are responsible for diseases such as Epidermolysis bullosa, sickle-cell disease, and SOD1 mediated ALS (Boillée 2006, p. 39).
A neutral mutation is a mutation that occurs in an amino acid codon which results in the use of a different, but chemically similar, amino acid. The similarity between the two is enough that little or no change is often rendered in the protein. For example, a change from AAA to AGA will encode arginine, a chemically similar molecule to the intended lysine.
Silent mutations are mutations that do not result in a change to the amino acid sequence of a protein. They may occur in a region that does not code for a protein, or they may occur within a codon in a manner that does not alter the final amino acid sequence. The phrase silent mutation is often used interchangeably with the phrase synonymous mutation; however, synonymous mutations are a subcategory of the former, occurring only within exons. The name silent could be a misnomer. For example, a silent mutation in the exon/intron border may lead to alternative splicing by changing the splice site (see Splice site mutation), thereby leading to a changed protein. Silent mutations occur because of the degenerate nature of the genetic code.
This thread is now on it's 80th page, and there is not one scrap of evidence supporting creation...Why is that? Could it be that creationists have none?
The point still stands. While a mutation may be beneficial for survival in a particular situation, it still accounts for a LOSS of INFORMATION not a gain. That particular mutation won't improve survival for ALL situations and doesn't CREATE a more advanced CREATURE - just one more adapted to that particular situation. DNA is information. We never see NEW INFORMATION in mutations. Maybe a copy, but not NEW INFORMATION. It requires a HUGE LEAP OF FAITH to believe the complexity we see in nature has evolved in a series of reactions that are merely speculated throughout eons of time reached through assumptions that evolution is true.
This is so laden with misinformation, I can't even begin to wonder how your education took you so far astray. Your argument is akin to saying that words are full of letters, but new words never have new letters and therefore any change in words must come at a loss of letters.
In a previous post, I explained in rather deep detail how mutations work and how we can identify a positive or negative (or neutral) mutation in the gene pool. But, first, to continue my analogy with words and letters, I'd like to point out that the four nucleotides which comprise our DNA (Adenine, Guanine, Thymine, and Cytosine) are often identified by their first letter (A,G,C or T) when stringing out DNA codes that could literally be millions of lines long. When you see DNA coded out, it looks like this:
CTTGAACCTTTGTCACCCCTCACGTTGCACACCAAAGACA
Just as clarification, we do this so we don't have to make it look like this:
Thus, when you read a DNA code, you are merely reading off the nucleotides in order. Since there are only four of them and since we use letters to represent individual nucleotides, we often think of the four nucleotides as the "DNA Alphabet." In other words, we have four letters representing our nucleotides, which can be put in any order, and each set (3 letters) actually codes for a certain amino acid.
The amino acids are important because they are the building blocks of proteins. And, well, proteins are important because they do all the "work" of the gene. So, therefore, the first string of DNA I showed above (which was the first line in the FOXP2 gene) was an "instruction set" that coded for where to place certain amino acids.
We could further break it down as such, so you can get an idea of how this works:
As you see, each three letter "set" codes for an amino acid. Those "sets," by the way, are called codons. That's easy to remember because they CODE for a certain amino acid.
Now, when DNA replicates, sometimes it adds a few codons, sometimes it deletes a few codons, and sometimes it merely just changes a few codons. Genetically, when we are looking for changes mutations, we examine the genetic code, and more specifically the codons, to see where the changes have occurred within a given population and what was "selected" for.
It should be important to note that many codons will code for the same amino acid. Let's take the first one in our FOXP2 gene, CTT - which codes for Leucine, and examine how changes to the codon could affect it:
As we've already mentioned, CTT codes for Leucine. Leucine, being an amino acid, and as we've also already mentioned, is a building block of a certain protein, will carry out a certain "mission." When the DNA replicates, it is possible that the codon may change. So, for example, if CTT was transcribed incorrectly and was turned into CTC what would happen? Well, believe it or not, nothing would happen because CTT and CTC both code for the same amino acid - Leucine! This is what is called a synonymous mutation. When the codon changes but can still code for the same thing, it is like using a synonym to another word to get the point across. I should note here that CTT, CTC, CTA and CTG all code for Leucine.
Now comes the interesting part... What happens if the first letter is changed in our codon from CTT to TTT? Well, that is an entirely different story altogether! TTT certainly does not code for Leucine... In fact, it codes for Phenylalanine which is a completely different amino acid altogether. This is what is called a non-synonymous mutation - where the codon change does not code for the same thing. And, since we now have a different amino acid assigned to the original place, it is now going to have a different protein doing the work... This can be good or bad.
When we sweep a population, we look for positive ratios of non-synonymous mutations and we look for negative ratios of non-synonymous mutations. If a population shows that a change in a non-synonymous mutation appears to be present more frequently in one population as opposed to another population, we can determine that the mutation was a positive one - simply because it's very obvious that having that mutation is obviously more beneficial towards reproduction than not having it. On the flip side, if the changes showed a net loss in the population dynamics, its factor of mutational advantages is obviously a negative one and is thus considered a negative mutation. There are also plenty of changes which are "in between" where their change has no real positive or negative effect but the change in the codon is indeed different. Those are obviously called neutral changes.
Nowhere, in any of this, is there a loss of information. If anything, certain changes will actually add DNA rather than take it away. Yet, your whole concept of losing information to mutations is radically incorrect, is not reflective of how biology or genetics works and is nothing more than a loose quote from an anti-science, anti-knowledge website that makes money infecting people with stupidity and misinformation.
Now, think back to the analogy I gave you between words and letters. We have a twenty-six letter alphabet of which we can make an almost endless string of words and those words make up our "language" which we call English. But, we know that English did not just pop up one day. There was not a baby born speaking English much to the dismay of his or her Barbarian parents in what is now Germany. Our English language stems from German, Latin and Greek (mostly) and has evolved over time. Different letters, different words, and different usages pop in and out of existence over time and is largely dependent on the population dynamics of those who use them. I can't be certain of it as I haven't read over my Shakespeare in a while, but I'm quite sure the words "Boom-Shakalaka" and "Gangsta" were never used. That is probably because those words didn't exist at the time, and yet, here they are today, somehow present and, in some places, doing quite well in their own niche.
Rather than give us what other people are saying about Gee's beliefs, why don't you give us the actual words of Gee himself where he claims that he does not accept evolution?
I already told you he accepts evolution. No claims have been made that he doesn't.
BTW - Did Gee tell the truth?
Is there something in that quote that is wrong?
Quote:
Originally Posted by Rafius
Do you have any evidence that there was a "WHO" involved?
What would you regard as "evidence?"
Life only comes from life. Is this true? If you choose to deny this, maybe you can show me how evolution began. No bedtime stories now.
Is there any "evidence" that life began all on its own?
Is it even reasonable to assume that it did? If you cannot prove that life had a spontaneous beginning, then SOMEONE must have put it here.
Show me your "evidence" and I'll show you mine.
.
I already told you he accepts evolution. No claims have been made that he doesn't.
BTW - Did Gee tell the truth?
Is there something in that quote that is wrong?
What would you regard as "evidence?"
Life only comes from life. Is this true? If you choose to deny this, maybe you can show me how evolution began. No bedtime stories now.
Is there any "evidence" that life began all on its own?
Is it even reasonable to assume that it did?
Show me your "evidence" and I'll show you mine.
.
(\__/)
( ‘ .‘ )
>(^)<
Wilson
You have been shown lots of evidence for evolution, and now I challenge you to show me even one piece of evidence for creation...Keep in mind that bible babble is NOT evidence.
I already told you he accepts evolution. No claims have been made that he doesn't.
BTW - Did Gee tell the truth?
Is there something in that quote that is wrong?
What would you regard as "evidence?"
Life only comes from life. Is this true? If you choose to deny this, maybe you can show me how evolution began. No bedtime stories now.
Is there any "evidence" that life began all on its own?
Is it even reasonable to assume that it did? If you cannot prove that life had a spontaneous beginning, then SOMEONE must have put it here.
Show me your "evidence" and I'll show you mine.
.
(\__/)
( ‘ .‘ )
>(^)<
Wilson
That is the most brilliant thing said on this entire thread.
"life comes from Life" - Wilson Cole
HAHAHAHAAAAAAAAAAAAAAA!!! Bless him Father Yahua!!!
So then does that mean you accept evolution? Incidentally how life began is off topic since it is a different subject altogether.
Your right, that's off topic. But of course I don't believe we evolved from monkeys. I've already told you that I "know" God, and that means He's given me the insight, understanding, knowledge, and revelation that mankind began as... mankind.
The Almighty, the one who made all those things out there that scientists are so in awe of, is the most precious thing that exists and He is not just something to be thrown out there for everyone to see, and mock, and hate. It doesn't surprise me that something so holy and pure is kept hidden, only for those who are truely thankfull for their existence and would never follow Satan in a rebellion against their maker.
We were created a little lower than Elohim, so that we can acually grow into His children. Satan on the other hand was created in an extremely glorious state of being - so great that he thought too highly of himself.
What does all that have to do with evolution? It's the only evolution I believe in. I'm living it right now as we speak. That's a fact.
Psalm 73
10 And so the people are dismayed and confused,
drinking in all their words.
11 “What does God know?” they ask.
“Does the Most High even know what’s happening?”
12 Look at these wicked people—
enjoying a life of ease while their riches multiply.
13 Did I keep my heart pure for nothing?
Did I keep myself innocent for no reason?
14 I get nothing but trouble all day long;
every morning brings me pain.
15 If I had really spoken this way to others,
I would have been a traitor to your people.
16 So I tried to understand why the wicked prosper.
But what a difficult task it is!
17 Then I went into your sanctuary, O God,
and I finally understood the destiny of the wicked.
18 Truly, you put them on a slippery path
and send them sliding over the cliff to destruction.
19 In an instant they are destroyed,
completely swept away by terrors.
20 When you arise, O Lord,
you will laugh at their silly ideas
as a person laughs at dreams in the morning. 21 Then I realized that my heart was bitter,
and I was all torn up inside.
22 I was so foolish and ignorant—
I must have seemed like a senseless animal to you.
23 Yet I still belong to you;
you hold my right hand.
24 You guide me with your counsel,
leading me to a glorious destiny.
25 Whom have I in heaven but you?
I desire you more than anything on earth.
Your right, that's off topic. But of course I don't believe we evolved from monkeys. I've already told you that I "know" God, and that means He's given me the insight, understanding, knowledge, and revelation that mankind began as... mankind.
The Almighty, the one who made all those things out there that scientists are so in awe of, is the most precious thing that exists and He is not just something to be thrown out there for everyone to see, and mock, and hate. It doesn't surprise me that something so holy and pure is kept hidden, only for those who are truely thankfull for their existence and would never follow Satan in a rebellion against their maker.
We were created a little lower than Elohim, so that we can acually grow into His children. Satan on the other hand was created in an extremely glorious state of being - so great that he thought too highly of himself.
What does all that have to do with evolution? It's the only evolution I believe in. I'm living it right now as we speak. That's a fact.
You are right about one thing...It is true that we didn't evolve from monkeys, but you are wrong about everything else.
Please register to post and access all features of our very popular forum. It is free and quick. Over $68,000 in prizes has already been given out to active posters on our forum. Additional giveaways are planned.
Detailed information about all U.S. cities, counties, and zip codes on our site: City-data.com.
Please register to participate in our discussions with 2 million other members - it's free and quick! Some forums can only be seen by registered members. After you create your account, you'll be able to customize options and access all our 15,000 new posts/day with fewer ads.
