Welcome to City-Data.com Forum!
U.S. CitiesCity-Data Forum Index
Go Back   City-Data Forum > General Forums > Science and Technology
 [Register]
Please register to participate in our discussions with 2 million other members - it's free and quick! Some forums can only be seen by registered members. After you create your account, you'll be able to customize options and access all our 15,000 new posts/day with fewer ads.
View detailed profile (Advanced) or search
site with Google Custom Search

Search Forums  (Advanced)
 
Old 08-20-2012, 01:31 PM
 
Location: Planet Eaarth
8,954 posts, read 20,671,929 times
Reputation: 7193

Advertisements

This is the stuff of Star Trek!!!!!

Writing the Book in DNA | HMS
Reply With Quote Quick reply to this message

 
Old 08-22-2012, 12:48 PM
 
Location: deafened by howls of 'racism!!!'
52,708 posts, read 34,520,329 times
Reputation: 29284
pretty cool.
Quote:
About four grams of DNA theoretically could store the digital data humankind creates in one year.
i've been sending DNA-o-grams for over ten years.

GTTGAGCTTATGGGTTAAGATCTCGCCATGCTAGTAGGCTAGGGAATGCT GGGCGACATGGCATAAGCTGGGCTTCTGATGGGCTACCTTGTAATGGTTG AGCTTATGGCGCGTTCCTCAATGGAAGGCTAT

decode here
Reply With Quote Quick reply to this message
Reply
Please update this thread with any new information or opinions. This open thread is still read by thousands of people, so we encourage all additional points of view.

Quick Reply
Message:

Over $104,000 in prizes was already given out to active posters on our forum and additional giveaways are planned!

Go Back   City-Data Forum > General Forums > Science and Technology
Similar Threads

All times are GMT -6. The time now is 06:14 PM.

© 2005-2024, Advameg, Inc. · Please obey Forum Rules · Terms of Use and Privacy Policy · Bug Bounty

City-Data.com - Contact Us - Archive 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 - Top